|
XB-LINE-2058
Line Name: Xtr.tyremOchi
| Summary | |
|---|---|
| Synonym: | Xtr.tyrtmOchi |
| Species: | Xenopus tropicalis |
| Background Strain: | Xtr.inbred |
| Description: | An albino line with CRISPR/Cas9-targeted mutation in tyrosinase (tyr) gene, made by the Ochi Lab. The target sequence is in exon 1 [GGAAAGGAACATGGTCCCTC]. |
| Phenotype Description: | |
| Color Morph: | albino |
| Breeding Type: | OUTBRED |
| Lab of Origin: | Ochi Lab |
| Line Type: | Mutant |
| Mutated Gene(s): | tyr |
| MTA Required: | Yes |
| Public: | Yes |
| Catalog Number: | HUARC_2004 |
| Anatomical Phenotypes: | tyr |
| Disease Phenotypes: | tyr |
| Stock Center | RRID | Generation | DOB | # Males | # Females | Availability | Mutant Details |
|---|---|---|---|---|---|---|---|
| NBRP (Japan) | HUARC_2004 | F1 | Inquire | Inquire | Order | adult male and females available |
Back to Search Lines